Top » Catalog » R1a » A19467

$18.00

A19467
[A19467]

A19467
hg38 Position: ChrY:8981993..8981993
Ancestral: C
Derived: A
Reference: John Orr (2017)
ISOGG Haplogroup: R1a
Comments:
Forward Primer: A19467_F CCAATTTGACCCACAAAACC
Reverse Primer: A19467_R AAAACTTCCCCAGGTCTTCC
Reviews

Customers who bought this product also purchased
A19469
A19469
A19473
A19473
A19472
A19472
A19471
A19471
A19470
A19470
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x BY20089
$18.00
Haplogroup Info
Other products
Currencies