Top » Catalog » R1a » FGC21112

$18.00

FGC21112
[FGC21112]

FGC21112
hg38 Position: ChrY:20838947..20838947
Ancestral: T
Derived: C
Reference: Full Genomes Corp. (2014)
ISOGG Haplogroup: R1a
Comments: .
Forward Primer: FGC21112_F TGCTCTATTTGCTCAAAATTGG
Reverse Primer: FGC21112_R TGCAAAAATTAGTGGCATTTTC
Reviews

Customers who bought this product also purchased
A19113
A19113
FGC21103
FGC21103
A19080
A19080
A19152
A19152
FGC21108
FGC21108
A19093
A19093
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x BY20089
1 x FGC7387
$36.00
Haplogroup Info
Other products
Currencies