Top » Catalog » R1a » A11121

$18.00

A11121
[A11121]

A11121
hg38 Position: ChrY:6803882..6803882
Ancestral: G
Derived: A
Reference: John Orr (2016)
ISOGG Haplogroup: R1a
Comments: .
Forward Primer: A11121_F CCAAAAATGTTTGTCAATCTATGC
Reverse Primer: A11121_R TGGCTCCAGATAAAGGCTTC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies