Top » Catalog » R1a » SUR58

$18.00

SUR58
[SUR58]

SUR58
hg38 Position: ChrY:13374366..13374366
Ancestral: A
Derived: G
Reference: Bulat Muratov (2014)
ISOGG Haplogroup: R1a (not listed)
Comments: Approx. Y2632
Forward Primer: SUR58_F TACAGGGCACATGCCATTAC
Reverse Primer: SUR58_R GGCACCATGTCATTTGGATG
Reviews

Customers who bought this product also purchased
SUR51
SUR51
SUR76
SUR76
SUR56
SUR56
SUR85
SUR85
SUR63
SUR63
SUR13
SUR13
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x BY32028
1 x A23760
1 x FGC5911
$54.00
Haplogroup Info
Other products
Currencies