Top » Catalog » R1a » SUR64

$18.00

SUR64
[SUR64]

SUR64
hg38 Position: ChrY:17250075..17250075
Ancestral: A
Derived: G
Reference: Bulat Muratov (2014)
ISOGG Haplogroup: R1a (not listed)
Comments: Approx. Y2632
Forward Primer: SUR64_F TGAGGACCATCTGTGTCTGC
Reverse Primer: SUR64_R TGACTGCTCATCCCAGAGAAG
Reviews

Customers who bought this product also purchased
SUR55
SUR55
SUR83
SUR83
SUR12
SUR12
SUR60
SUR60
SUR95
SUR95
SUR3
SUR3
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x Y4036
1 x A8087
1 x Y7297
1 x FGC19543
1 x Y38728
1 x KMS143
1 x A5979
1 x Y3612
1 x A10260
$162.00
Haplogroup Info
Other products
Currencies