Top » Catalog » R1a » SUR64

$18.00

SUR64
[SUR64]

SUR64
hg38 Position: ChrY:17250075..17250075
Ancestral: A
Derived: G
Reference: Bulat Muratov (2014)
ISOGG Haplogroup: R1a (not listed)
Comments: Approx. Y2632
Forward Primer: SUR64_F TGAGGACCATCTGTGTCTGC
Reverse Primer: SUR64_R TGACTGCTCATCCCAGAGAAG
Reviews

Customers who bought this product also purchased
SUR14
SUR14
SUR63
SUR63
SUR51
SUR51
SUR76
SUR76
SUR56
SUR56
SUR85
SUR85
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies