Top » Catalog » R1a » SUR72

$18.00

SUR72
[SUR72]

SUR72
hg38 Position: ChrY:7739878..7739878
Ancestral: C
Derived: T
Reference: Bulat Muratov (2014)
ISOGG Haplogroup: R1a (not listed)
Comments: Approx. Y2632
Forward Primer: SUR72_F GCCAAACAATTGAACCAAAG
Reverse Primer: SUR72_R GGTAGGAAAGTGGGGAGAGG
Reviews

Customers who bought this product also purchased
SUR12
SUR12
SUR60
SUR60
SUR95
SUR95
SUR3
SUR3
SUR73
SUR73
SUR54
SUR54
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies