Top » Catalog » R1a » FGC66338

$18.00

FGC66338
[FGC66338]

FGC66338
hg38 Position: ChrY:19933303..19933303
Ancestral: G
Derived: A
Reference: Full Genomes Corp. (2017)
ISOGG Haplogroup: R1a
Comments: L1029 > FGC66342
Forward Primer: FGC66338_F GTGACAAAGCCATAATAGTGTAAACG
Reverse Primer: FGC66338_R TTTCTGCTTGGTAAGTTTTTTATTACTTATG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x Y7447
1 x A9989
1 x Y12540
1 x BY11402
1 x FGC21113
1 x Y12622
$108.00
Haplogroup Info
Other products
Currencies