Top » Catalog » R1a » A20978

$18.00

A20978
[A20978]

A20978
hg38 Position: ChrY:16734951..16734951
Ancestral: G
Derived: A
Reference: Hamit Koci (2018)
ISOGG Haplogroup: R1a
Comments: Below L1029
Forward Primer: A20978_F GTGTATATGTCCAGGAATTTATCCG
Reverse Primer: A20978_R ACATAGCAGAATACTTGGGACAGC
Reviews

Customers who bought this product also purchased
Y133352
Y133352
Y133383
Y133383
Y133368
Y133368
Y133364
Y133364
Y133360
Y133360
Y133359
Y133359
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies