Top » Catalog » R1a » S23297

$18.00

S23297
[S23297]

S23297
hg38 Position: ChrY:19420381..19420381
Ancestral: C
Derived: T
Reference: Jim Wilson (2014)
ISOGG Haplogroup: R1a
Comments: Below L664
Forward Primer: S23297_F CTTTCCAGTCTTCCTTTTCTACAGATG
Reverse Primer: S23297_R GTTCATCTGGGGAGAGGGC
Reviews

Customers who bought this product also purchased
FGC19058
FGC19058
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC5943
1 x FGC12832
1 x A12499
1 x BY9874
1 x S9378
1 x Y12645
1 x BY188919
1 x MF669
$144.00
Haplogroup Info
Other products
Currencies