Top » Catalog » R1a » FGC18222

$18.00

FGC18222
[FGC18222]

FGC18222
hg38 Position: ChrY:15352625..15352625
Ancestral: T
Derived: C
Reference: Full Genomes Corp. (2014)
ISOGG Haplogroup: R1a (not listed)
Comments: Downstream Z93 > Z94 > Z2124 > Z2122 > F1345 > Y2619
Forward Primer: FGC18222_F AGATACCAGCTGTAACAGTGGAGTAC
Reverse Primer: FGC18222_R TACTTCTCAGGGAAGGCCAG
Reviews

Customers who bought this product also purchased
Y2630
Y2630
Z2123
Z2123
YP4488
YP4488
F1345
F1345
YP4672
YP4672
Z2124
Z2124
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A19103
1 x A18707
$36.00
Haplogroup Info
Other products
Currencies