Top » Catalog » R1a » FGC18222

$18.00

FGC18222
[FGC18222]

FGC18222
hg38 Position: ChrY:15352625..15352625
Ancestral: T
Derived: C
Reference: Full Genomes Corp. (2014)
ISOGG Haplogroup: R1a (not listed)
Comments: Downstream Z93 > Z94 > Z2124 > Z2122 > F1345 > Y2619
Forward Primer: FGC18222_F AGATACCAGCTGTAACAGTGGAGTAC
Reverse Primer: FGC18222_R TACTTCTCAGGGAAGGCCAG
Reviews

Customers who bought this product also purchased
A1244
A1244
R1a-Z93 Panel
R1a-Z93 Panel
YP264
YP264
Y2630
Y2630
Z2123
Z2123
YP4488
YP4488
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies