Top » Catalog » R1a » A373

$18.00

A373
[A373]

A373
hg38 Position: ChrY:21409377..21409377
Ancestral: G
Derived: A
Reference: Scott Rodger (2014)
ISOGG Haplogroup: R1a1a1b1a3a1a (not listed)
Comments: Aka YP508. below L176.1
Forward Primer: A373_F GCAGGATTCCTGAGATGGGT
Reverse Primer: A373_R CTGATGGCCATTTCTCCAAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x DYS636
1 x DYR112
1 x DYR76
1 x DYS389I+II
1 x DYS534
1 x DYS537
1 x DYS494
1 x DYS638
$84.65
Haplogroup Info
Other products
Currencies