Top » Catalog » R1a » A22561

$18.00

A22561
[A22561]

A22561
hg38 Position: ChrY:20620113..20620113
Ancestral: C
Derived: A
Reference: Frantisek Kristofoli (2018)
ISOGG Haplogroup: R1a
Comments:
Forward Primer: A22561_F ATGCCTTCTTCTCTCACCTCG
Reverse Primer: A22561_R CCTCTGTAGACTCCAGCTCTGC
Reviews

Customers who bought this product also purchased
A22560
A22560
A22559
A22559
A22556
A22556
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x SK2015
1 x JN85
1 x FGC32030
$54.00
Haplogroup Info
Other products
Currencies