Top » Catalog » R1a » FGC21097

$18.00

FGC21097
[FGC21097]

FGC21097
hg38 Position: ChrY:15364955..15364955
Ancestral: T
Derived: G
Reference: Full Genomes Corp. (2014)
ISOGG Haplogroup: R1a
Comments: Below S3485
Forward Primer: FGC21097_F GTCCAGAACTTGTTCATCTCCTG
Reverse Primer: FGC21097_R GCAGGTGAACAGCCAGGATAC
Reviews

Customers who bought this product also purchased
Y2893
Y2893
FGC21099
FGC21099
FGC21098
FGC21098
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A7458
$18.00
Haplogroup Info
Other products
Currencies