Top » Catalog » R1a » BY108143

$18.00

BY108143
[BY108143]

BY108143
hg38 Position: ChrY:14373592..14373592
Ancestral: C
Derived: A
Reference: FTDNA (2018)
ISOGG Haplogroup: R1a
Comments: .
Forward Primer: BY108143_F CCATAGAGAAAAATAATCGACATGG
Reverse Primer: BY108143_R GTGAGTCACTGCACCCTGTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC45075
1 x A6594
$36.00
Haplogroup Info
Other products
Currencies