Top » Catalog » R1a » BY74083

$18.00

BY74083
[BY74083]

BY74083
hg38 Position: ChrY:8697296..8697296
Ancestral: G
Derived: T
Reference: FTDNA (2018)
ISOGG Haplogroup: R1a
Comments: .
Forward Primer: BY74083_F CCTCCTACAAAGTGCCAACG
Reverse Primer: BY74083_R GATGTGGCTTCCATAAATGCTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A22944
1 x FGC9927
1 x A9541
1 x Y93842
$72.00
Haplogroup Info
Other products
Currencies