Top » Catalog » R1b » A2221

$18.00

A2221
[A2221]

A2221
hg38 Position: ChrY:7770068..7770068
Ancestral: T
Derived: A
Reference: James Kane (2015)
ISOGG Haplogroup: R1b1a1a2a1a2c1c1b1a1b4b
Comments: Found in CTS4466 samples. Downstream of S1121.
Forward Primer: A2221_F TGCTGCATTCACATCTAGAAGAC
Reverse Primer: A2221_R TGCCATAGGTTGATGAGAGC
Reviews

Customers who bought this product also purchased
A923
A923
A1511
A1511
A664
A664
Z17981
Z17981
FGC11150
FGC11150
R1b-FGC11134 Panel (including CTS4466)
R1b-FGC11134 Panel (including CTS4466)
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A1193
1 x A683
$36.00
Haplogroup Info
Other products
Currencies