Top » Catalog » R1b » A2221

$18.00

A2221
[A2221]

A2221
hg38 Position: ChrY:7770068..7770068
Ancestral: T
Derived: A
Reference: James Kane (2015)
ISOGG Haplogroup: R1b1a1a2a1a2c1c1b1a1b4b
Comments: Found in CTS4466 samples. Downstream of S1121.
Forward Primer: A2221_F TGCTGCATTCACATCTAGAAGAC
Reverse Primer: A2221_R TGCCATAGGTTGATGAGAGC
Reviews

Customers who bought this product also purchased
Z17981
Z17981
A923
A923
A1511
A1511
A664
A664
A195
A195
A159
A159
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies