Top » Catalog » R1b » A2222

$18.00

A2222
[A2222]

A2222
hg38 Position: ChrY:13202534..13202534
Ancestral: T
Derived: C
Reference: James Kane (2015)
ISOGG Haplogroup: R1b1a1a2a1a2c1c1b1a1b4b
Comments: Found in CTS4466 samples. Downstream of S1121.
Forward Primer: A2222_F ACTTTGGAGGGTGGAGGAAG
Reverse Primer: A2222_R TTGGGGAAATAGTGTTAAGGATG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A1075
1 x A58
$36.00
Haplogroup Info
Other products
Currencies