Top » Catalog » R1b » A2222

$18.00

A2222
[A2222]

A2222
hg38 Position: ChrY:13202534..13202534
Ancestral: T
Derived: C
Reference: James Kane (2015)
ISOGG Haplogroup: R1b1a1a2a1a2c1c1b1a1b4b
Comments: Found in CTS4466 samples. Downstream of S1121.
Forward Primer: A2222_F ACTTTGGAGGGTGGAGGAAG
Reverse Primer: A2222_R TTGGGGAAATAGTGTTAAGGATG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A635
1 x A677
1 x A2127
1 x A104
1 x A952
1 x A966
1 x A800
1 x A183
1 x A2156
1 x A1229
1 x A47
1 x A561
1 x A1039
1 x A1295
1 x A1225
1 x A2252
1 x A1262
1 x A478
1 x A1257
1 x A1737
1 x A1320
1 x A1089
$396.00
Haplogroup Info
Other products
Currencies