Top » Catalog » R1b » A2202

$18.00

A2202
[A2202]

A2202
hg38 Position: ChrY:6934439..6934439
Ancestral: G
Derived: C
Reference: Iain Kennedy (2015)
ISOGG Haplogroup: R1b (not listed)
Comments: Below DF85
Forward Primer: A2202_F TTCTCCTTCTCCCCTGAAGC
Reverse Primer: A2202_R GGACAAGAGTGAGACCCCATC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A410
1 x A1170
1 x A2150
1 x A187
$72.00
Haplogroup Info
Other products
Currencies