Top » Catalog » R1b » A2203

$18.00

A2203
[A2203]

A2203
hg38 Position: ChrY:8689008..8689008
Ancestral: G
Derived: C
Reference: Iain Kennedy (2015)
ISOGG Haplogroup: R1b (not listed)
Comments: Below DF85
Forward Primer: A2203_F AACTCAGGTCCCCTTCAAGC
Reverse Primer: A2203_R TCAACAGCACTACCGGACAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies