Top » Catalog » R1b » A2204

$18.00

A2204
[A2204]

A2204
hg38 Position: ChrY:12120022..12120022
Ancestral: C
Derived: T
Reference: Iain Kennedy (2015)
ISOGG Haplogroup: R1b (not listed)
Comments: Below DF85
Forward Primer: A2204_F TTAATCTGTTATATGTATGCATCTTGTGAG
Reverse Primer: A2204_R GTATTACAGTAAATGGCAAACCCG
Reviews

Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies