Top » Catalog » R1b » A2204

$18.00

A2204
[A2204]

A2204
hg38 Position: ChrY:12120022..12120022
Ancestral: C
Derived: T
Reference: Iain Kennedy (2015)
ISOGG Haplogroup: R1b (not listed)
Comments: Below DF85
Forward Primer: A2204_F TTAATCTGTTATATGTATGCATCTTGTGAG
Reverse Primer: A2204_R GTATTACAGTAAATGGCAAACCCG
Reviews

Customers who bought this product also purchased
BY21215
BY21215
A15499
A15499
FGC19851
FGC19851
M222
M222
DF85
DF85
FGC19846
FGC19846
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies