Top » Catalog » R1b » A2205

$18.00

A2205
[A2205]

A2205
hg38 Position: ChrY:16095416..16095416
Ancestral: G
Derived: C
Reference: Iain Kennedy (2015)
ISOGG Haplogroup: R1b (not listed)
Comments: Below DF85
Forward Primer: A2205_F TGCCCATCTATGGATAACTGC
Reverse Primer: A2205_R CTCTGAATGCAGTTGGGATG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A687
1 x A1343
1 x A1504
1 x A807
1 x A593
1 x A564
1 x A2233
1 x A340
1 x A1265
1 x A1191
1 x A420
1 x A735
1 x A172
1 x A508
1 x A2223
1 x A235
1 x A59
1 x A385
1 x A1290
$342.00
Haplogroup Info
Other products
Currencies