Top » Catalog » R1b » A2206

$18.00

A2206
[A2206]

A2206
hg38 Position: ChrY:17107008..17107008
Ancestral: G
Derived: A
Reference: Iain Kennedy (2015)
ISOGG Haplogroup: R1b (not listed)
Comments: Below DF85
Forward Primer: A2206_F GGCATCATCTTGAGTTGAATGTAG
Reverse Primer: A2206_R CCATTTCCCCGTTCATACAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A253
$18.00
Haplogroup Info
Other products
Currencies