Top » Catalog » R1b » A2207

$18.00

A2207
[A2207]

A2207
hg38 Position: ChrY:19452064..19452064
Ancestral: A
Derived: G
Reference: Iain Kennedy (2015)
ISOGG Haplogroup: R1b (not listed)
Comments: Below DF85
Forward Primer: A2207_F ACCAAGCAGAACAGCAAAGC
Reverse Primer: A2207_R GCAGTCTGTGCCTCTGTGTC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies