Top » Catalog » R1b » A2208

$18.00

A2208
[A2208]

A2208
hg38 Position: ChrY:20028422..20028422
Ancestral: T
Derived: A
Reference: Iain Kennedy (2015)
ISOGG Haplogroup: R1b (not listed)
Comments: Below DF85 > A2204
Forward Primer: A2208_F CCAAGCAGTCAAAGCAATTC
Reverse Primer: A2208_R GGTCCTTCAAGTCCATTTTTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A1147
1 x A909
1 x A1204
1 x A628
1 x A2190
1 x A679
$108.00
Haplogroup Info
Other products
Currencies