Top » Catalog » R1b » A2209

$18.00

A2209
[A2209]

A2209
hg38 Position: ChrY:20353898..20353898
Ancestral: A
Derived: G
Reference: Iain Kennedy (2015)
ISOGG Haplogroup: R1b (not listed)
Comments: Below DF85
Forward Primer: A2209_F CCTGTCACCCAGAATGGAG
Reverse Primer: A2209_R GATGGTGGTGAATTATCTTTTGG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A2268
$18.00
Haplogroup Info
Other products
Currencies