Top » Catalog » R1b » A2210

$18.00

A2210
[A2210]

A2210
hg38 Position: ChrY:20739476..20739476
Ancestral: G
Derived: A
Reference: Iain Kennedy (2015)
ISOGG Haplogroup: R1b (not listed)
Comments: Below DF85
Forward Primer: A2210_F AGGATCTTGCCCCATTTCTC
Reverse Primer: A2210_R AAGCCTCAGCTCTTGTGGAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A592
1 x A1174
1 x A33
1 x A2132
1 x A1171
1 x A171
1 x A1292
1 x A1339
1 x A2121
1 x A2123
1 x A2151
1 x A2197
1 x A1782
1 x A637
1 x A859
1 x A247
1 x A2125
$306.00
Haplogroup Info
Other products
Currencies