Top » Catalog » R1b » A2201

$18.00

A2201
[A2201]

A2201
hg38 Position: ChrY:20436371..20436371
Ancestral: A
Derived: C
Reference: Peter Bradley (2015)
ISOGG Haplogroup: R1b (not listed)
Comments: Below Z251 > Z16944
Forward Primer: A2201_F TCCAATACCTAGAAATGTACTTAGCC
Reverse Primer: A2201_R TCTGCATTCTCTCTTCTGTTATATTG
Reviews

Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A1313
$18.00
Haplogroup Info
Other products
Currencies