Top » Catalog » R1b » A2231

$18.00

A2231
[A2231]

A2231
hg38 Position: ChrY:7809196..7809196
Ancestral: T
Derived: A
Reference: Bruce Cockburn (2015)
ISOGG Haplogroup: R1b1a2a1a1b1a1 (not listed)
Comments: Downstream L257
Forward Primer: A2231_F CCTGCATATGTAGTCAAGAGTCAATC
Reverse Primer: A2231_R CTGCAGCCCTTGCTTTATG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies