Top » Catalog » R1b » A2237

$18.00

A2237
[A2237]

A2237
hg38 Position: ChrY:22309122..22309122
Ancestral: G
Derived: T
Reference: Bruce Cockburn (2015)
ISOGG Haplogroup: R1b1a2a1a1b1a1 (not listed)
Comments: Downstream L257
Forward Primer: A2237_F GGGTGTTGAATTATGGGAGAAGA
Reverse Primer: A2237_R AATACTGTCATACAAGGAAGGAGACCT
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A640
1 x A1230
1 x A2159
1 x A1499
1 x A238
1 x A1753
1 x A1490
1 x A534
1 x A1064
1 x A494
1 x A588
1 x A772
1 x A739
1 x A1746
1 x A387
1 x A647
1 x A299
1 x A1340
1 x A796
1 x A2199
1 x A736
$378.00
Haplogroup Info
Other products
Currencies