Top » Catalog » R1b » A2238

$18.00

A2238
[A2238]

A2238
hg38 Position: ChrY:8919064..8919064
Ancestral: ins
Derived: del
Reference: Bruce Cockburn (2015)
ISOGG Haplogroup: R1b1a2a1a1b1a1 (not listed)
Comments: Downstream L257
Forward Primer: A2238_F GGGAGAGGGCACCAATTATAC
Reverse Primer: A2238_R GCCTTGGACTCAAAACATGC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A225
1 x A902
1 x A1259
1 x A1537
1 x A419
1 x A2219
1 x A603
1 x A777
1 x A206
1 x A625
1 x A2253
1 x A1160
1 x A317
1 x A803
1 x A2208
1 x A166
1 x A988
1 x A797
$324.00
Haplogroup Info
Other products
Currencies