Top » Catalog » R1b » A2240

$18.00

A2240
[A2240]

A2240
hg38 Position: ChrY:8614829..8614829
Ancestral: G
Derived: T
Reference: Wayne Kauffman (2015)
ISOGG Haplogroup: R1b1a2a1a1c2b2b1a1 (not listed)
Comments: Downstream of CTS2509
Forward Primer: A2240_F GGTCTGGCTCAACAATTTCC
Reverse Primer: A2240_R AAATGACCCACAACCTGGAC
Reviews

Customers who bought this product also purchased
A2242
A2242
A2247
A2247
A2246
A2246
A2245
A2245
A2243
A2243
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A1147
1 x A909
1 x A1204
1 x A628
1 x A2190
1 x A679
1 x A580
1 x A656
1 x A904
1 x A801
1 x A469
1 x A184
1 x A92
1 x A518
1 x A1784
$270.00
Haplogroup Info
Other products
Currencies