Top » Catalog » R1b » A2243

$18.00

A2243
[A2243]

A2243
hg38 Position: ChrY:10023719..10023719
Ancestral: T
Derived: C
Reference: Wayne Kauffman (2015)
ISOGG Haplogroup: R1b1a2a1a1c2b2b1a1 (not listed)
Comments: Downstream of CTS2509
Forward Primer: A2243_F AGAAATCTATTAGATAAATCCAGAAAAAGTTAC
Reverse Primer: A2243_R CTCCATAGTAGCTGCATCATTTTCT
Reviews

Customers who bought this product also purchased
A2245
A2245
A2242
A2242
A2240
A2240
A2247
A2247
A2246
A2246
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A410
1 x A1170
1 x A2150
1 x A187
$72.00
Haplogroup Info
Other products
Currencies