Top » Catalog » R1b » A2249

$18.00

A2249
[A2249]

A2249
hg38 Position: ChrY:14306230..14306230
Ancestral: A
Derived: T
Reference: Wayne Kauffman (2015)
ISOGG Haplogroup: R1b1a2a1a1c2b2b1a1 (not listed)
Comments: Downstream of CTS2509
Forward Primer: A2249_F CCTAAACAATAGGCAGAGATTCATCT
Reverse Primer: A2249_R GGCTGTCAGGATGCAATGAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A1343
1 x A1234
1 x A1049
$54.00
Haplogroup Info
Other products
Currencies