Top » Catalog » R1b » A2251

$18.00

A2251
[A2251]

A2251
hg38 Position: ChrY:14482561..14482561
Ancestral: A
Derived: T
Reference: Wayne Kauffman (2015)
ISOGG Haplogroup: R1b1a2a1a1c2b2b1a1 (not listed)
Comments: Downstream of CTS2509
Forward Primer: A2251_F CCTGTGATGCAGACAAAATCTC
Reverse Primer: A2251_R CAATTTGCAACAGGCTTCTTC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A889
$18.00
Haplogroup Info
Other products
Currencies