Top » Catalog » R1b » A2253

$18.00

A2253
[A2253]

A2253
hg38 Position: ChrY:15541251..15541251
Ancestral: T
Derived: A
Reference: Wayne Kauffman (2015)
ISOGG Haplogroup: R1b1a2a1a1c2b2b1a1 (not listed)
Comments: Downstream of CTS2509
Forward Primer: A2253_F GATTTAATGCCATTCATGACATATAAC
Reverse Primer: A2253_R GACATTATTGTGGTAACAATTTGCTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A1237
1 x A1781
1 x A2138
1 x A2247
1 x A1192
1 x A365
1 x A699
1 x A646
1 x A955
1 x A2134
1 x A674
1 x A2122
1 x A179
1 x A1336
1 x A1771
$270.00
Haplogroup Info
Other products
Currencies