Top » Catalog » R1b » A2255

$18.00

A2255
[A2255]

A2255
hg38 Position: ChrY:16704587..16704587
Ancestral: C
Derived: A
Reference: Wayne Kauffman (2015)
ISOGG Haplogroup: R1b1a2a1a1c2b2b1a1 (not listed)
Comments: Downstream of CTS2509
Forward Primer: A2255_F CCATGGGTAATGTGAAAGTATGTG
Reverse Primer: A2255_R TGGGTCCAGCCACAATTAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A1147
1 x A909
1 x A1204
1 x A628
1 x A2190
$90.00
Haplogroup Info
Other products
Currencies