Top » Catalog » R1b » A2261

$18.00

A2261
[A2261]

A2261
hg38 Position: ChrY:13416996..13416996
Ancestral: C
Derived: G
Reference: Wayne Kauffman (2015)
ISOGG Haplogroup: R1b1a2a1a1c2b2b1a1 (not listed)
Comments: Downstream of CTS2509
Forward Primer: A2261_F AGCTGAAGGATGAGCAGAGC
Reverse Primer: A2261_R GATCCGTCAGTGTTGCATTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies