Top » Catalog » R1b » A2263

$18.00

A2263
[A2263]

A2263
hg38 Position: ChrY:16530694..16530694
Ancestral: A
Derived: G
Reference: Wayne Kauffman (2015)
ISOGG Haplogroup: R1b1a2a1a1c2b2b1a1 (not listed)
Comments: Downstream of CTS2509
Forward Primer: A2263_F GTAACATGCAAAATAAATAGAGATGG
Reverse Primer: A2263_R GCACAGTGTCTGCTTTGATG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A306
1 x A1773
1 x A187
1 x A551
1 x A95
1 x A1322
1 x A410
1 x A975
1 x A135
1 x A359
1 x A510
1 x A337
1 x A629
1 x A467
1 x A1165
1 x A1161
1 x A462
1 x A1495
1 x A927
$342.00
Haplogroup Info
Other products
Currencies