Top » Catalog » R1b » A2264

$18.00

A2264
[A2264]

A2264
hg38 Position: ChrY:7201169..7201169
Ancestral: G
Derived: A
Reference: Wayne Kauffman (2015)
ISOGG Haplogroup: R1b1a2a1a1c2b2b1a1 (not listed)
Comments: Downstream of CTS2509
Forward Primer: A2264_F CATTCTGGAGGCAACAGTCC
Reverse Primer: A2264_R AAATGCTGGCCCATTATCTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A767
$18.00
Haplogroup Info
Other products
Currencies