Top » Catalog » R1b » A2266

$18.00

A2266
[A2266]

A2266
hg38 Position: ChrY:15709473..15709473
Ancestral: G
Derived: T
Reference: Wayne Kauffman (2015)
ISOGG Haplogroup: R1b1a2a1a1c2b2b1a1 (not listed)
Comments: Downstream of CTS2509
Forward Primer: A2266_F CCAGCCCAGCTACAAGAGAC
Reverse Primer: A2266_R GCACTGCTTCAAGTATGTCCATC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A130
1 x A1753
$36.00
Haplogroup Info
Other products
Currencies