Top » Catalog » R1b » A2267

$18.00

A2267
[A2267]

A2267
hg38 Position: ChrY:16111374..16111374
Ancestral: G
Derived: A
Reference: Wayne Kauffman (2015)
ISOGG Haplogroup: R1b1a2a1a1c2b2b1a1 (not listed)
Comments: Downstream of CTS2509
Forward Primer: A2267_F TTTTTCAGTCTGCTAGCTAATGAGTATTC
Reverse Primer: A2267_R ACAGAAATGCAAATGCAAACTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A100
1 x A2075
1 x A165
1 x A967
1 x A517
$90.00
Haplogroup Info
Other products
Currencies