Top » Catalog » R1b » A2269

$18.00

A2269
[A2269]

A2269
hg38 Position: ChrY:8933115..8933115
Ancestral: A
Derived: C
Reference: Wayne Kauffman (2015)
ISOGG Haplogroup: R1b1a1a2a1a1c2b2b1a1a1d2
Comments: Downstream of CTS2509
Forward Primer: A2269_F TGAAGATACAGTAATAGTTTCATGCACC
Reverse Primer: A2269_R TTACAAATATACAGACTTAAAAGCTTGCTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A1718
1 x A173
$36.00
Haplogroup Info
Other products
Currencies