Top » Catalog » R1b » A2269

$18.00

A2269
[A2269]

A2269
hg38 Position: ChrY:8933115..8933115
Ancestral: A
Derived: C
Reference: Wayne Kauffman (2015)
ISOGG Haplogroup: R1b1a1a2a1a1c2b2b1a1a1d2
Comments: Downstream of CTS2509
Forward Primer: A2269_F TGAAGATACAGTAATAGTTTCATGCACC
Reverse Primer: A2269_R TTACAAATATACAGACTTAAAAGCTTGCTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A447
1 x A250
1 x A441
1 x A671
1 x A579
1 x A1169
1 x A760
1 x A747
1 x A1491
1 x A1712
$180.00
Haplogroup Info
Other products
Currencies