Top » Catalog » R1b » A2270

$18.00

A2270
[A2270]

A2270
hg38 Position: ChrY:9995956..9995956
Ancestral: A
Derived: G
Reference: Wayne Kauffman (2015)
ISOGG Haplogroup: R1b1a2a1a1c2b2b1a1 (not listed)
Comments: Downstream of CTS2509
Forward Primer: A2270_F GGGCAAATGAGTGAAACATG
Reverse Primer: A2270_R GCCCAACGAGGCTGTTTATAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A935
1 x A2254
1 x A743
$54.00
Haplogroup Info
Other products
Currencies