Top » Catalog » R1b » A2270

$18.00

A2270
[A2270]

A2270
hg38 Position: ChrY:9995956..9995956
Ancestral: A
Derived: G
Reference: Wayne Kauffman (2015)
ISOGG Haplogroup: R1b1a2a1a1c2b2b1a1 (not listed)
Comments: Downstream of CTS2509
Forward Primer: A2270_F GGGCAAATGAGTGAAACATG
Reverse Primer: A2270_R GCCCAACGAGGCTGTTTATAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A1721
1 x A1036
1 x A1163
1 x A2155
1 x A113
1 x A1758
1 x A818
1 x A531
1 x A2220
1 x A2139
1 x A35
1 x A749
1 x A1369
1 x A773
1 x A1177
1 x A748
1 x A1303
1 x A1289
1 x A1702
1 x A1140
1 x A67
1 x A751
1 x A416
$414.00
Haplogroup Info
Other products
Currencies