Top » Catalog » R1b » A698

$18.00

A698
[A698]

A698
hg38 Position: ChrY:15000390..15000390
Ancestral: T
Derived: C
Reference: Joe Fox (2014)
ISOGG Haplogroup: R1b1a2a1a1c1a2a (not listed)
Comments: Below R-L1/S26
Forward Primer: A698_F GGGAATGTAAATCCAGTATCATCC
Reverse Primer: A698_R GAATATTGGGCCTGACAGTAGG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A2191
1 x A1166
1 x A1039
$54.00
Haplogroup Info
Other products
Currencies