Top » Catalog » R1b » A698

$18.00

A698
[A698]

A698
hg38 Position: ChrY:15000390..15000390
Ancestral: T
Derived: C
Reference: Joe Fox (2014)
ISOGG Haplogroup: R1b1a2a1a1c1a2a (not listed)
Comments: Below R-L1/S26
Forward Primer: A698_F GGGAATGTAAATCCAGTATCATCC
Reverse Primer: A698_R GAATATTGGGCCTGACAGTAGG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A342
1 x A1080
1 x A694
1 x A2170
1 x A7
1 x A1766
1 x A1141
1 x A570
1 x A2071
1 x A683
1 x A2146
1 x A554
1 x A970
1 x A680
1 x A191
1 x A185
1 x A463
$306.00
Haplogroup Info
Other products
Currencies